peptide SVVYGLR upregulates cell motility and facilitates oral mucosal wound therapeutic

gnrlbiotech

Electrostatically certain lanreotide peptide – gold nanoparticle conjugates for enhanced uptake in SSTR2-positive most cancers cells

Lanreotide peptide (LP) has excessive affinity to somatostatin receptors like SSTR2 and is often used within the remedy of neuro-endocrine tumors. The primary goal of this research is to focus on gold nanoparticles (AuNPs) in direction of SSTR2-positive most cancers cells utilizing lanreotide peptide (LP) because the focusing on agent for enhanced tumor uptake and antitumor exercise. pH mediated adjustments within the floor potential of LP and AuNP is used to put together electrostatically certain AuNP-LP complexes.

AuNP-LP complicated formation was demonstrated by UV-Seen spectroscopy, floor potential, dynamic mild scattering (DLS), small angle X-ray scattering and HR-TEM. Confocal microscopy and circulation cytometric research present that AuNP-LP complicated has greater mobile uptake in SSTR2 expressed most cancers cells (MCF-7 and AR42J) than in CHO cells. The improved mobile uptake of LP coated AuNPs result in ~1.5 to 2-fold GSH depletion and enhanced ROS era in MCF-7 cells.

The preferential cytotoxicity of the AuNP-LP complicated in direction of MCF-7 and AR42J cells, as revealed by MTT assay, is according to the elevated mobile uptake. Our research display that LP coated AuNP can be utilized as an efficient platform to selectively goal SSTR2 optimistic most cancers cells for mixture remedy approaches involving gold nanoparticles.

gnrlbiotech
gnrlbiotech


anti-BICD1
YF-PA23300 50 ul
EUR 334.00
Description: Mouse polyclonal to BICD1
BICD1 Conjugated Antibody
C43846 100ul
EUR 397.00
BICD1 Rabbit pAb
A18340-100ul 100 ul
EUR 308.00
BICD1 Rabbit pAb
A18340-200ul 200 ul
EUR 459.00
BICD1 Rabbit pAb
A18340-20ul 20 ul
EUR 183.00
BICD1 Rabbit pAb
A18340-50ul 50 ul
EUR 223.00
Anti-BICD1 antibody
STJ11100296 100 µl
EUR 277.00
Mouse BICD1 shRNA Plasmid
20-abx969353
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human BICD1 shRNA Plasmid
20-abx950432
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Bicd1 ORF Vector (Rat) (pORF)
ORF064060 1.0 ug DNA
EUR 506.00
BICD1 ORF Vector (Human) (pORF)
ORF016163 1.0 ug DNA
EUR 405.00
Bicd1 ORF Vector (Mouse) (pORF)
ORF039855 1.0 ug DNA
EUR 506.00
Bicd1 ORF Vector (Mouse) (pORF)
ORF039856 1.0 ug DNA
EUR 506.00
Bicd1 sgRNA CRISPR Lentivector set (Mouse)
K5013701 3 x 1.0 ug
EUR 339.00
Bicd1 sgRNA CRISPR Lentivector set (Rat)
K6328901 3 x 1.0 ug
EUR 339.00
BICD1 sgRNA CRISPR Lentivector set (Human)
K0183501 3 x 1.0 ug
EUR 339.00
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-48T 48T
EUR 527.00
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-96T 96T
EUR 688.00
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-48T 48T
EUR 398.00
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-96T 96T
EUR 511.00
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T 48T
EUR 450.00
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T 96T
EUR 582.00
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T 48T
EUR 467.00
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T 96T
EUR 605.00
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-48Tests 48 Tests
EUR 557.00
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-96Tests 96 Tests
EUR 774.00
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404.00
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556.00
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465.00
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643.00
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486.00
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672.00
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-48Tests 48 Tests
EUR 533.00
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-96Tests 96 Tests
EUR 740.00
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387.00
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532.00
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446.00
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615.00
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465.00
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643.00
Bicd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5013702 1.0 ug DNA
EUR 154.00
Bicd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5013703 1.0 ug DNA
EUR 154.00
Bicd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5013704 1.0 ug DNA
EUR 154.00
Bicd1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6328902 1.0 ug DNA
EUR 154.00
Bicd1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6328903 1.0 ug DNA
EUR 154.00
Bicd1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6328904 1.0 ug DNA
EUR 154.00
BICD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0183502 1.0 ug DNA
EUR 154.00
BICD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0183503 1.0 ug DNA
EUR 154.00
BICD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0183504 1.0 ug DNA
EUR 154.00
BICD1 Protein Vector (Mouse) (pPB-C-His)
PV159418 500 ng
EUR 1065.00
BICD1 Protein Vector (Mouse) (pPB-N-His)
PV159419 500 ng
EUR 1065.00
BICD1 Protein Vector (Mouse) (pPM-C-HA)
PV159420 500 ng
EUR 1065.00
BICD1 Protein Vector (Mouse) (pPM-C-His)
PV159421 500 ng
EUR 1065.00
BICD1 Protein Vector (Mouse) (pPB-C-His)
PV159422 500 ng
EUR 1065.00
BICD1 Protein Vector (Mouse) (pPB-N-His)
PV159423 500 ng
EUR 1065.00
BICD1 Protein Vector (Mouse) (pPM-C-HA)
PV159424 500 ng
EUR 1065.00
BICD1 Protein Vector (Mouse) (pPM-C-His)
PV159425 500 ng
EUR 1065.00
BICD1 Protein Vector (Rat) (pPB-C-His)
PV256238 500 ng
EUR 1191.00
BICD1 Protein Vector (Rat) (pPB-N-His)
PV256239 500 ng
EUR 1191.00
BICD1 Protein Vector (Rat) (pPM-C-HA)
PV256240 500 ng
EUR 1191.00
BICD1 Protein Vector (Rat) (pPM-C-His)
PV256241 500 ng
EUR 1191.00
BICD1 Protein Vector (Human) (pPB-His-MBP)
PV326902 500 ng
EUR 811.00
BICD1 Protein Vector (Human) (pPB-His-GST)
PV326903 500 ng
EUR 811.00
BICD1 Protein Vector (Human) (pPB-C-His)
PV064649 500 ng
EUR 811.00
BICD1 Protein Vector (Human) (pPB-N-His)
PV064650 500 ng
EUR 811.00
BICD1 Protein Vector (Human) (pPM-C-HA)
PV064651 500 ng
EUR 811.00
BICD1 Protein Vector (Human) (pPM-C-His)
PV064652 500 ng
EUR 811.00
Bicd1 3'UTR GFP Stable Cell Line
TU152749 1.0 ml Ask for price
Bicd1 3'UTR Luciferase Stable Cell Line
TU102749 1.0 ml Ask for price
Bicd1 3'UTR Luciferase Stable Cell Line
TU201328 1.0 ml Ask for price
Bicd1 3'UTR GFP Stable Cell Line
TU251328 1.0 ml Ask for price
BICD1 3'UTR GFP Stable Cell Line
TU051777 1.0 ml
EUR 1394.00
BICD1 3'UTR Luciferase Stable Cell Line
TU001777 1.0 ml
EUR 1394.00
Mouse Protein bicaudal D homolog 1, Bicd1 ELISA KIT
ELI-12046m 96 Tests
EUR 865.00
Human Protein bicaudal D homolog 1, BICD1 ELISA KIT
ELI-49976h 96 Tests
EUR 824.00
BICD1 Protein Vector (Human) (pPM-N-D-C-HA)
PV326904 500 ng
EUR 1014.00
BICD1 Protein Vector (Human) (pPM-N-D-C-His)
PV326905 500 ng
EUR 1014.00
Bicd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K5013705 3 x 1.0 ug
EUR 376.00
Bicd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6328905 3 x 1.0 ug
EUR 376.00
BICD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0183505 3 x 1.0 ug
EUR 376.00

Artificial peptide SVVYGLR upregulates cell motility and facilitates oral mucosal wound therapeutic

Osteopontin-derived SVVYGLR (SV) 7-amino-acid sequence is a multifunctional and artificial SV peptide implicated in angiogenesis, manufacturing of collagen III, and fibroblast differentiation into myofibroblasts. This research investigated the impact of the SV peptide on mucosal wound therapeutic exercise. Regular human-derived gingival fibroblasts (NHGF) and human oral mucosa keratinocytes (HOMK) had been used for in vitro experiments.

As well as, an oral punch wound was ready on the buccal mucosa in male rats aged 11 weeks, and we evaluated the impact of native injection of SV peptide on wound therapeutic. The artificial SV peptide confirmed no affect on the proliferation and adhesion properties of NHGF and HOMK, however it enhanced the cell motility and migration actions. TGF-β1 receptor inhibitor, SB431542 or SB505124, considerably suppressed the SV peptide-induced migration exercise, suggesting an involvement of TGF-β1 receptor activation. Moreover, SV peptide accelerated the therapeutic means of an in vivo oral wound mannequin, in contrast with management teams.

Additional immunohistological staining of wound tissue revealed that a rise in capillary progress and the higher variety of fibroblasts and myofibroblasts that migrated into the wound space would possibly contribute to the facilitation of the therapeutic course of produced by the SV peptide. The SV peptide has helpful results on oral wound therapeutic via enhancement of the sooner section consisting of angiogenesis and reworking with granulation tissue. The artificial SV peptide could be a helpful remedy possibility, significantly for intractable mucosal wounds brought on by trauma or surgical procedure for progressive lesions similar to oral most cancers.

Characterization and Quantitative Willpower of a Various Group of Bacillus subtilis subsp. subtilis NCIB 3610 Antibacterial Peptides

5 antibacterial peptides produced by Bacillus subtilis NCIB 3610 had been purified, quantified, characterised, and recognized within the current research. Cell-free extracts had been subjected to 3 purification protocols using ammonium sulfate or natural solvent precipitation and their mixture, adopted by ion-exchange chromatography, solid-phase extraction, and preparative high-performance liquid chromatography (HPLC).

The mixed ammonium sulfate and natural solvent precipitation extraction protocol introduced the very best outcomes for peptide purification. Within the 5 fractions that introduced antimicrobial exercise, antibacterial peptides had been quantified by the turbidometric technique and by HPLC utilizing nisin for exterior calibration, with the second offering extra correct outcomes. All peptides had been pH- and temperature-resistant and their sensitivity to proteases remedy indicated their proteinic nature.

 The 5 peptides had been subjected to microwave-assisted acid hydrolysis (MAAH) and following derivatization had been analyzed utilizing norleucine as the inner customary, to find out their amino acid content material. The identification of the remoted peptides utilizing the UniProt and PubChem databases indicated that the 4 peptides correspond to UniProt entries of the bacteriocins Subtilosin-A (Q1W152) Subtilosin-SbOX (H6D9P4), Ericin B (Q93GH3), Subtilin (P10946), and the fifth to the non-ribosomal antibacterial lipopeptide surfactin (CID:443592).

The amino acid content material willpower and computational analyses, utilized within the current work on the antimicrobial peptides of B. subtilis, proved an environment friendly screening and quantification technique of bacteriocins that would doubtlessly be utilized in different bacterial strains. The constructed phylogenetic timber heterogeneity noticed throughout the 5 peptides investigated is perhaps indicative of aggressive benefit of the pressure.

Mouse Protein INCA1, Inca1 ELISA KIT

ELI-27217m 96 Tests
EUR 865.00

INCA1 Antibody

25023-100ul 100ul
EUR 390.00

INCA1 Antibody

1-CSB-PA605764LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INCA1. Recognizes INCA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

INCA1 siRNA

20-abx920597
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

INCA1 siRNA

20-abx920598
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

INCA1 Antibody (HRP)

20-abx306705
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

INCA1 Antibody (FITC)

20-abx306706
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

INCA1 Antibody (Biotin)

20-abx306707
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

INCA1 cloning plasmid

CSB-CL605764HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: ATGCAGGTGCAGGATGATGGAGTCAACCTCATCCCCTTTGCCAAGTGTTCCAGGGTGGTCAGCCGATCTCCACCCCCAAGGTTGCCTTCCCAGAGCCTCAGACCCATGCCCCAGCGTTATGGAGATGTCTTCTGGAAGAACCTTAATCAAAGGCCCACCCCCACTTGGCTGGAGGA
  • Show more
Description: A cloning plasmid for the INCA1 gene.

INCA1 Polyclonal Antibody

A64606 100 µg
EUR 570.55
Description: fast delivery possible

INCA1 Antibody, HRP conjugated

1-CSB-PA605764LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INCA1. Recognizes INCA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

INCA1 Antibody, FITC conjugated

1-CSB-PA605764LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INCA1. Recognizes INCA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

INCA1 Antibody, Biotin conjugated

1-CSB-PA605764LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INCA1. Recognizes INCA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human INCA1 shRNA Plasmid

20-abx967785
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse INCA1 shRNA Plasmid

20-abx979603
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

INCA1 Recombinant Protein (Human)

RP040087 100 ug Ask for price

INCA1 Recombinant Protein (Rat)

RP206012 100 ug Ask for price

INCA1 Recombinant Protein (Mouse)

RP143804 100 ug Ask for price

INCA1 Recombinant Protein (Mouse)

RP143807 100 ug Ask for price

INCA1 Recombinant Protein (Mouse)

RP143810 100 ug Ask for price

INCA1 Recombinant Protein (Mouse)

RP143813 100 ug Ask for price

INCA1 Recombinant Protein (Mouse)

RP143816 100 ug Ask for price

Polyclonal INCA1 Antibody (C-Terminus)

APR02723G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human INCA1 (C-Terminus). This antibody is tested and proven to work in the following applications:

INCA1 Polyclonal Antibody, HRP Conjugated

A64607 100 µg
EUR 570.55
Description: reagents widely cited

INCA1 Polyclonal Antibody, FITC Conjugated

A64608 100 µg
EUR 570.55
Description: Ask the seller for details

INCA1 Polyclonal Antibody, Biotin Conjugated

A64609 100 µg
EUR 570.55
Description: The best epigenetics products

Inca1 ORF Vector (Rat) (pORF)

ORF068672 1.0 ug DNA
EUR 506.00

INCA1 ORF Vector (Human) (pORF)

ORF013363 1.0 ug DNA
EUR 354.00

Inca1 ORF Vector (Mouse) (pORF)

ORF047936 1.0 ug DNA
EUR 506.00

Inca1 ORF Vector (Mouse) (pORF)

ORF047937 1.0 ug DNA
EUR 506.00

Inca1 ORF Vector (Mouse) (pORF)

ORF047938 1.0 ug DNA
EUR 506.00

Inca1 ORF Vector (Mouse) (pORF)

ORF047939 1.0 ug DNA
EUR 506.00

Inca1 ORF Vector (Mouse) (pORF)

ORF047940 1.0 ug DNA
EUR 506.00

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 527.00
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 688.00
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 398.00
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 511.00
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450.00
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582.00
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467.00
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605.00
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 557.00

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 774.00

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404.00

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556.00

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465.00

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643.00

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486.00

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672.00

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 533.00

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 740.00

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387.00

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532.00

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446.00

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615.00

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465.00

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643.00

Inca1 sgRNA CRISPR Lentivector set (Rat)

K6645901 3 x 1.0 ug
EUR 339.00

Inca1 sgRNA CRISPR Lentivector set (Mouse)

K3663501 3 x 1.0 ug
EUR 339.00

INCA1 sgRNA CRISPR Lentivector set (Human)

K1087201 3 x 1.0 ug
EUR 339.00

Inca1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6645902 1.0 ug DNA
EUR 154.00

Inca1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6645903 1.0 ug DNA
EUR 154.00

Inca1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6645904 1.0 ug DNA
EUR 154.00

Inca1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3663502 1.0 ug DNA
EUR 154.00

Inca1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3663503 1.0 ug DNA
EUR 154.00

Inca1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3663504 1.0 ug DNA
EUR 154.00

INCA1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1087202 1.0 ug DNA
EUR 154.00

INCA1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1087203 1.0 ug DNA
EUR 154.00

INCA1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1087204 1.0 ug DNA
EUR 154.00

INCA1 Protein Vector (Rat) (pPB-C-His)

PV274686 500 ng
EUR 603.00

INCA1 Protein Vector (Rat) (pPB-N-His)

PV274687 500 ng
EUR 603.00

INCA1 Protein Vector (Rat) (pPM-C-HA)

PV274688 500 ng
EUR 603.00

INCA1 Protein Vector (Rat) (pPM-C-His)

PV274689 500 ng
EUR 603.00

INCA1 Protein Vector (Mouse) (pPB-C-His)

PV191742 500 ng
EUR 603.00

INCA1 Protein Vector (Mouse) (pPB-N-His)

PV191743 500 ng
EUR 603.00

INCA1 Protein Vector (Mouse) (pPM-C-HA)

PV191744 500 ng
EUR 603.00

INCA1 Protein Vector (Mouse) (pPM-C-His)

PV191745 500 ng
EUR 603.00

INCA1 Protein Vector (Mouse) (pPB-C-His)

PV191746 500 ng
EUR 603.00

INCA1 Protein Vector (Mouse) (pPB-N-His)

PV191747 500 ng
EUR 603.00

INCA1 Protein Vector (Mouse) (pPM-C-HA)

PV191748 500 ng
EUR 603.00

Leave a Reply

Your email address will not be published. Required fields are marked *